Mito-SiPE е независим от последователността метод за обогатяване на mtDNA без PCR за високоточно митохондриално секвениране.

Развъждане и събиране на тъкани

Мишките бяха настанени в клетки с кутии за обувки и хранени със системата ProLab RMH 1800 (PMI Nutrition International), съдържаща 50 μg витамин B12/kg диета и 3,3 mg фолиева киселина/kg диета. Мишките за разплод се хранят с Picolab Mouse Diet 20, съдържаща 51 μg витамин B12/kg диета и 2,9 mg фолиева киселина/kg диета. Хетерозиготни гражданинТегло / D257A мъжки f гражданинТегло / D257A Женските са чифтосани. Хомозиготно и диво мутантно потомство е било на възраст до 6 месеца, след което е било умъртвено. Имаше 4 гражданинтегло / тегл мишки (две мъжки и две женски) и 4 гражданинD257A/D257A Мишки (мъжки и женски) използвани в гражданин експерименти. Бяха изолирани тъкани от мозък, сърце, бял дроб, черен дроб, далак, бъбрек и мускули и беше извършено обогатяване на митохондриална ДНК върху всички тъкани.

Тъканна хомогенизация

Събраните тъкани се поставят в епруветка за хомогенизиране с обем 10 × на грам пресен буфер за хомогенизиране, т.е. 5 mL от 500 mg тъканен буфер. Тъканта се хомогенизира, докато не се забележи цяла тъкан. След това хомогенатът се прехвърля в микроцентрофужни епруветки от 1,5 ml и се върти при 1000 × ж за 1 минута при 4 °C. Супернатантът се прехвърля в нова микроцентрофужна епруветка и се върти при 12 000 ×ж за 10 минути при 4 °C за утаяване на митохондриите. Митохондриалната пелета се ресуспендира със 100 µL разтвор за ресуспендиране за съхранение или за незабавна екстракция на ДНК.

Изолиране на митохондриална ДНК от свежи миши тъкани

Ресуспендираните митохондрии се добавят към 200 μl алкален лизисен буфер, разбъркват се и се поставят върху лед за 5 минути. След това се добавя разтвор на калиев ацетат (150 uL), сместа се разбърква бавно и се поставя върху лед за 5 минути. Сместа се центрофугира при 12 000 ×ж за 5 минути при 4 °C за утаяване на протеините и супернатантата се декантира в нова епруветка. РНКаза (1 μg) се добавя към сместа и се оставя на стайна температура за 15 минути. Към всяка епруветка се добавя фенолхлороформ (500 μl), разбърква се и се поставя върху шейкър/ротатор за 20 минути. След това центрофугирайте при 12 000 × ж за две минути при стайна температура. Водният (горен) слой се декантира в нова епруветка (450 μl се възстановяват от този етап) и се добавят 40 μl натриев ацетат, 1 μl гликоген (20 mg/mL) и 1200 μl 100% EtOH. Сместа се разбърква и се смесва добре, след което се оставя върху сух лед за 60 минути. Сместа се центрофугира при 12 000 × ж Супернатантата беше отстранена. Накрая пелетите бяха промити два пъти със 70% етанол, изсушени на въздух и ресуспендирани в ниско-TE буфер за секвениране или обикновен TE буфер за (q)PCR.

Подготовка на библиотека и секвениране на ДНК от следващо поколение

Библиотеките бяха генерирани от приблизително 50 ng геномна ДНК с помощта на Accel-NGS 2S Plus DNA Library Kit (Swift Biosciences), използвайки пет цикъла на PCR за минимизиране на PCR отклонението. ДНК пробите се срязват чрез ултразвук (Covaris Inc., Woburn, MA) със средно 300 bp. Библиотеките бяха маркирани с уникални ДНК баркодове с двоен индекс, за да се позволи агрегиране на библиотеки и да се намали въздействието на навигацията с баркод. Библиотеките бяха обединени за секвениране на NovaSeq 6000 (Illumina), за да се получат 7,6 милиона двойки за четене от 151 бази на отделна библиотека. Данните за секвениране бяха обработени с помощта на RTA версия 3.4.4. Секвенирането на ДНК е извършено във вътрешния център за секвениране на Националния институт по здравеопазване.

Обработка и подравняване на данни

Файловете Fastq бяха подравнени към референтния геном на мишката, GRCm38, с помощта на bwa mem, използвайки параметри по подразбиране.47. Инструментите на Picard бяха използвани за добавяне на набори за четене и за маркиране и премахване на дубликати48. Samtools беше използван за изчисляване на покритието в ядрените и митохондриалните геноми за всяка проба. И накрая, R (v3.5.0) и ggplot2 (v3.3.0) бяха използвани за статистически анализ и последваща визуализация на графики.49,50. Сложността на библиотеката и размерите на фрагментите бяха изчислени с помощта на Picard Tools v1.4.2 в 15 произволно избрани проби (допълнителни данни 2).

Извикване на варианти и анализ на мутации

Извикването на променлива беше направено с помощта на bcftools v1.9 с ‘bcftools mpileup -f -Q 30 –skip-indels reference_fasta bam_file | bcftools извиква -mv ‘ за избор само на варианти с единичен нуклеотид. Филтрирането беше извършено чрез премахване на всички SNV с QUAL резултат по-малък от 20. Кодът, използван за подравняване и извиквания на променливи, е наличен в github (https://github.com/walshd59/mtDNAhetScripts.git). От 66 738 варианта, идентифицирани във всички проби в нашето изследване с алтернативна алелна честота ≥0,2%, само 137 са имали ln стойност (коефициент на вероятност на веригата) ≥3. Анализът на мутационния спектър и по-нататъшното характеризиране/анотация на хетерозиготните варианти беше извършено с помощта на SnpEff (версия 5.1)51.

Количествено определяне на броя на копията на мтДНК

Броят на копията на митохондриална ДНК беше оценен чрез qPCR, насочен към митохондриални и ядрени места, както е описано по-горе.52,53. Накратко, 2,5 μL LightCycler® 480 SYBR Green I Master (Roche, Molecular Systems, Inc, Германия), 2 μL ДНК (20 ng/μL) и 0,5 μL праймерна смес се добавят в три екземпляра към 384-ямкова плака и реакциите. Тя беше извършена от QuanStudio 6 Flex (Applied Biosystems, Foster City, CA, USA). Условията са както следва: 95°С за 5 минути, 45 цикъла от 95°С за 10 секунди, 60°С за 10 секунди и 72°С за 20 секунди. Беше направена крива на топене при 95°С за 5 секунди, 66°С за 1 минута и постепенно повишаване до 97°С. Броят на копията на митохондриалната ДНК беше оценен с помощта на следното уравнение:

$$2times {2}^{varDelta {{{{rm{Ct}}}}}}}({{{{rm{къде}}}}}},varDelta {{{ {{ rm{Ct}}}}}}={{{{{rm{Ct}}}}}}({{{{rm{mtDNA}}}}},{{{{rm{ген} } }}}}) – {{{{rm{Ct}}}}}}({{{{rm{nDNA}}}}}, {{{{rm{ген}}}}}}} $ $

(1)

Следните праймери бяха използвани за номер на копие на човешка mtDNA: mtDNA tRNA (напред: CACCCAAGAACAGGGTTGT, назад: TGGCCATGGGTATGTTGTTA) ядрен ДНК β2-микроглобулин (напред: TGCTGTCTCCATGTTTGATGTCTACTG), назад: TGGCCATGGGTATGTTGTTA) Миши mtDNA номер на копие беше DNDmt оценен с помощта на следния номер на копие на mtDNA: (Напред: CTAGCAGAAACAAACCGGGC, назад: CCGGCTGCGTATTCTACGTT) HK2 ДНК (напред: GCCAGCCTCTCCTGATTTTAGTGT, назад: GGGAACACACTAGACCT). Тези праймери са налични във файла с допълнителни данни (допълнителни данни 3).

PCR обогатяване на дълги разстояния за mtDNA

Тази техника е използвана за амплифициране на човешка и миша ДНК в две части от цял ​​ДНК екстракт. ДНК беше количествено определенаПрез Nanodrop (Методи 2.2.7), освен ако не е посочено друго. Всяка PCR реакция се състои от Q5 HD полимераза (0,02 U/μL), 5X Q5 реакционен буфер (1X), 10 mM dNTPs (300 μM), 5 μM прави и обратни праймери (0,25 μM). Към всяка реакция се добавя шаблонна ДНК (100 ng) с изключение на контролата без шаблон (NTC), но вместо това се добавя еквивалентен обем вода с клас молекулярна биология. Температурните цикли са както следва: 1 x 30 sec денатурация 98°C, 25 x 10 sec денатурация 98°C, 30 sec отгряване 66°C, 4 min 30 sec удължаване 72°C, 1 x 10 min 72° елонгация по Целзий на термоциклер. И двете части бяха измерени с Qubit и смесени в равни пропорции. Следните праймери бяха използвани за всеки фрагмент: lrPCR фрагмент 1 (напред: GGATCCTACTCTCTACAAAC, назад: TAGTTTGCCGCGTTGGGTGG) и lrPCR фрагмент 2 (напред: CTACCCCCTTCAATCAATCT, назад: CCGGTTTGTTCTGCTAGGG). Тези префикси са налични и във файла с допълнителни данни (допълнителни данни 3).

Изолиране на митохондрии чрез комплект Qiagen QProteome™

HepG2 клетки (2 х 106) се събират, преброяват и пелетират, когато се достигне 80% от пула. Супернатантата беше отстранена и пелетата беше ресуспендирана в лизисния буфер, предоставен в комплекта. След това се извършва хомогенизиране и изолиране на митохондриите съгласно протокола на производителя. Накратко, клетъчната пелета се суспендира в 1.5 mL ледено студен буфер за разрушаване чрез пипетиране нагоре и надолу с помощта на 1 mL пипета. Разкъсването на клетката беше завършено с помощта на тъпа игла и спринцовка. Сместа се центрофугира при 1000 × ж за 10 минути при 4 °C за утаяване на протеините и супернатантата се декантира в нова епруветка. След това центрофугирайте при 6000×ж за две минути при стайна температура. След това тези пелети се ресуспендират в 200 μL PBS и 20 μL протеиназа К. След това се извършва екстракция на ДНК върху митохондриални изолати чрез Qiagen DNeasy™ комплект за кръв и тъкани, като се използва протоколът на производителя.

Plasmid-Safe™ Digest за обогатяване на РНК

Екстрактите от цяла ДНК бяха обработени с безопасна за плазмид ATP-базирана екзонуклеаза (Lucigen) съгласно протокола на производителя. Накратко, безопасен за плазмид разтвор се генерира с помощта на 42 μl стерилна вода, 2 μl 25 mM ATP, 5 μl 10X реакционен разтвор и 1 μl безопасна за плазмид ДНКаза. ДНКазата е насочена към линейни молекули и като такава не разгражда митохондриалната ДНК, тъй като е кръгла. Разтворът се добавя към ДНК, екстрахирана с помощта на QIAprep miniprep, и се инкубира при 37°С за 1 час. След това ДНКазата се инактивира чрез инкубиране при 70 °С в продължение на 30 минути.

Условия за култивиране на HepG2

HepG2 клетки (Merck; 85011430-1VL) Те бяха култивирани в модифицирана среда на Dulbecco на Eagle (DMEM), допълнена с 10% фетален говежди серум в 5% CO.2 гледачка. Клетките се отглеждат в 10 mL среда в T75 колби. Клетките бяха пасирани чрез промиване с 5 ml PBS (1 X), последвано от инкубиране в 2 ml 0.25% трипсин-EDTA при 37 ° С за 5 минути. Трипсинизацията се инхибира чрез добавяне на 4 ml DMEM. След това клетките се събират чрез центрофугиране при 500 × ж за 5 минути преди броене.

Qiagen QIAprep минипреп

HepG2 клетки (2 х 106) се събират, преброяват и пелетират, когато се достигне 80% от пула. Супернатантата беше отстранена и пелетата беше ресуспендирана в лизисния буфер, предоставен в комплекта. Изолирането на ДНК се извършва съгласно протокола на производителя, като се използва силициева мембрана за улавяне на mtDNA, която впоследствие се събира в 100 μl от предоставения буфер за елуиране.

Статистика и възпроизводство

Всички статистически анализи, включени в тази статия, бяха извършени в софтуерния пакет R (версия 4.1.1) и rstatix ​​(версия 0.7.0). Размерите на пробите са описани във всяка експериментална фигура. Извършени са тестове за ранг на сайта на Wilcoxon за сравняване на броя на копията на mtDNA от необогатени и обогатени проби от различни тъкани (н= 14 на група). Бяха проведени и тестове за ранг на Wilcoxon за сравняване на ефекта от lrPCR и Mito-SiPE амплификацията върху митохондриалната хетерогенност вгражданинтегло / тегл И награжданинD257A/D257A (н= 24 за всеки генотип). СтудентРТестът беше използван за сравняване на ефекта на lrPCR и Mito-SiPE върху вариабилността при C57BL6 мишки от див тип (н= 6 за lrPCR групата,н= 12 за групата Mito-SiPE).

Решение

Използвани са следните разтвори: хомогенизиращ буфер (0,25 М захароза, 10 mM EDTA, 30 mM Tris-HCl, pH = 7,5), буфер за ресуспендиране (10 mM Tris, 0,15 M NaCl, 10 mM EDTA, pH pH = 8,0), алкален хидролизен буфер (0,18 N NaOH, 1% SDS, прясно приготвен), калиев ацетатен буфер (3 М калий, 5 М ацетат) и ниско-TE буфер (10 mM Tris-HCl, 0,1 mM EDTA, pH киселинност = 8,0).

Резюме на отчетите

Повече информация за дизайна на изследването е достъпна в резюмето на доклада на Nature Portfolio, свързано с тази статия.